Construction of an expression system of Epstein-Barr Virus thymidine kinase（TK）
Abstract：Objective：To construct a recombinant plasmid which can express large amounts of the Epstein-Barr-virus-coded thymidine kinase．Methods：The plasmid PUC8X was used as a template for PCR with the 5’primer GTGAATTCATGGCTGGATTTCC and the 3’primer CAACTGCAGCCTAGTCCCGATT to generate a fragment with a 5’EcoR I site and a 3’Pst I site．The DNA was cut to produce an EcoR I-Pst I fragment that was ligated into the similarly cut vector pBV220 with T4 ligase．Results：The recombmant DNA pBV220-tk was constructed，which was cut by EcoR I and Pst I and analyzed by agarose gel electrophoresis．Two bands at 1．8 kb and 3．6 kb were obtained．The pBV220-tk was used as a template for PCR with two primers indicated above，the PCR-generated fragment was at 1．8 kb analyzed by agarose gel electrophoresis．Conclusion：The aimed gene tk has been inserted into the pBV220 successfully．
Machine-generated Keywords：
Publication Date：2001-01-01
Online Publishing Date：2025-08-15(First online date of this platform, not the publication date of the document)
Pages：2( 4-5 )